View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19724_low_13 (Length: 277)
Name: NF19724_low_13
Description: NF19724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19724_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 38091672 - 38091916
Alignment:
| Q |
10 |
attatactctcaaactctactcattgtgtctgtcagtgttaaatttaagatctttatactaaataaaattccaactttaaataatgttataaaattaact |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
38091672 |
attatactctcaaactctactcattgtgtctgttagtgttaaattttagatctttatactaaataaaattctaactttaaaaaatgttataaaattaact |
38091771 |
T |
 |
| Q |
110 |
catagttttgatttttcttcttgagctgagtactagctcaagatgtagctcaaaatttgacaagtgcaaaaaggtatgctgtacttgtgcatgcaattga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38091772 |
catagttttgatttttcttcttgagctgagtactagctcaagatctagctcaaaatttgacaagtgcaaaaaggtatgttgtacttgtgcatgcaattga |
38091871 |
T |
 |
| Q |
210 |
acttggaggtatctcgcagtcatgcgcatgcacgtgatcaccatc |
254 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38091872 |
acttggaggtatcttgcagtcatgcgcatgcacgtgatcaccatc |
38091916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University