View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19724_low_19 (Length: 210)

Name: NF19724_low_19
Description: NF19724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19724_low_19
NF19724_low_19
[»] chr1 (1 HSPs)
chr1 (13-193)||(87896-88076)


Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 87896 - 88076
Alignment:
13 taattctataataactcatatcatatgaaaacgaaaatgattagattttgcacttcnnnnnnnccaagtgtggttaaaactaaagtggcagctaggtagc 112  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||       ||||||||||||||||||||||| |||||||||||||    
87896 taattctataataactcatatcatatgaaaacgaaaatgaatagattttgcacttctttttttccaagtgtggttaaaactaaagtcgcagctaggtagc 87995  T
113 tagttcctaatatgtaaaatgttgggggtgaaaatagttataaagtgccaaattaaaattgcaggaaaattgagtcaatca 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
87996 tagttcctaatatgtaaaatgttgggggtgaaaatagttataaagtgccaaattaaaattgcaggaaaattgagtcaatca 88076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University