View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19724_low_19 (Length: 210)
Name: NF19724_low_19
Description: NF19724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19724_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 87896 - 88076
Alignment:
| Q |
13 |
taattctataataactcatatcatatgaaaacgaaaatgattagattttgcacttcnnnnnnnccaagtgtggttaaaactaaagtggcagctaggtagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
87896 |
taattctataataactcatatcatatgaaaacgaaaatgaatagattttgcacttctttttttccaagtgtggttaaaactaaagtcgcagctaggtagc |
87995 |
T |
 |
| Q |
113 |
tagttcctaatatgtaaaatgttgggggtgaaaatagttataaagtgccaaattaaaattgcaggaaaattgagtcaatca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87996 |
tagttcctaatatgtaaaatgttgggggtgaaaatagttataaagtgccaaattaaaattgcaggaaaattgagtcaatca |
88076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University