View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19725_high_14 (Length: 238)

Name: NF19725_high_14
Description: NF19725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19725_high_14
NF19725_high_14
[»] chr2 (1 HSPs)
chr2 (18-220)||(45689883-45690085)


Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 45689883 - 45690085
Alignment:
18 catttttggtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggctgtgagggtgagtgctgctagc 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
45689883 catttttggtttgtgtaatatcaaaaggatcgtcaggatcaacgaggaggtcatcgtcatcgtcgttggcagcggggccgtgagggtgagtgctgctagc 45689982  T
118 aatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctc 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45689983 aatggtgacggtgaggagaccattggaggatgaggatgaaccatgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctc 45690082  T
218 ttc 220  Q
    |||    
45690083 ttc 45690085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University