View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_high_36 (Length: 308)
Name: NF19726_high_36
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 290
Target Start/End: Original strand, 21651770 - 21652043
Alignment:
| Q |
17 |
taatccatattagtgctaggaaacaaaccaaatggtatgnnnnnnncatccctttcccctcgatttttggttgacaatgtacaggctgaggtttttcgct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21651770 |
taatccatattagtgctaggaaacaaaccaaatggtatgtttttttcatccctttcccctcgatttttggttgacaatgtacaggctgaggtttttcgct |
21651869 |
T |
|
| Q |
117 |
cttaaataaaacttgagaattcttgaagcagttcgtcgtatctaagcttttacttcttatactgttttatgcaggtggtatgctaaaaggtttttgcatc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21651870 |
cttaaataaaacttgagaattcttgaagcagtttgtcatatctaagcttttacttcttatactgttttatgcaggtggtatgctaaaaggtttttgcatc |
21651969 |
T |
|
| Q |
217 |
ctgatattgtggcagcgtacgaatacatttttatatgggacgaagatctaggattggacaacttcaatggagac |
290 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21651970 |
ctgatattgtggcagcgtatgaatacatttttatatgggacgaagatctaggactggacaacttcaatggagac |
21652043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 265
Target Start/End: Original strand, 37455830 - 37455906
Alignment:
| Q |
189 |
aggtggtatgctaaaaggtttttgcatcctgatattgtggcagcgtacgaatacatttttatatgggacgaagatct |
265 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| ||||||||| | || || || |||||||||||||| |||||||| |
|
|
| T |
37455830 |
aggtggtatgctaaacggtttctgcatcctgacattgtggcaccttatgactatatttttatatgggatgaagatct |
37455906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 188 - 294
Target Start/End: Complemental strand, 40419907 - 40419801
Alignment:
| Q |
188 |
caggtggtatgctaaaaggtttttgcatcctgatattgtggcagcgtacgaatacatttttatatgggacgaagatctaggattggacaacttcaatgga |
287 |
Q |
| |
|
|||||||||||||||||||||| |||| || |||||||| |||| || ||||| ||||| || ||||| |||||||| ||| |||| ||||||| || |
|
|
| T |
40419907 |
caggtggtatgctaaaaggtttctgcaccccgatattgtatcagcttatgaatatattttaatctgggatgaagatcttggagtggaacacttcaacggg |
40419808 |
T |
|
| Q |
288 |
gacaagt |
294 |
Q |
| |
|
||||||| |
|
|
| T |
40419807 |
gacaagt |
40419801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University