View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_high_41 (Length: 294)
Name: NF19726_high_41
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 123 - 273
Target Start/End: Complemental strand, 51039734 - 51039584
Alignment:
| Q |
123 |
agtattgtatctgaaacataaatcaatggacctcttgtcctggattctagacggagtagcttcaattatcatatctcaagctgaaatttcatgcatgctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
51039734 |
agtattgtatctgaaacataaatcaatggacctcttgtcctggattctagacggagtagcttcaattatcatatctcaagctgaaatttcatgcatactt |
51039635 |
T |
 |
| Q |
223 |
gaaatgtttttcacactttcaatatgatgacatcaacattttggcatctct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51039634 |
gaaatgtttttcacactttcaatatgatgacatcaacattttggcatctct |
51039584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 51039847 - 51039795
Alignment:
| Q |
1 |
aagagcataatgacgacccacagaacacagcacatcgataacaaaatcaaata |
53 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
51039847 |
aagagcagaatgacgacccacaaaacacagcacatcgataactaaatcaaata |
51039795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University