View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_high_61 (Length: 235)
Name: NF19726_high_61
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 10710198 - 10710404
Alignment:
| Q |
11 |
gaagaatatgcatgcaaagaaagagatatggagttacaatatctaaatcaaagtgtgagagcaacaagtgataagaaagtttcatttgaagggtcacaag |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10710198 |
gaagaaaatgcatgcaaagaaagagatatggagttacaatatctaaatcaaagtgtgagaacaactagtgataagaaagtttcatttgaagggtcacaag |
10710297 |
T |
 |
| Q |
111 |
acacacttgatagtaaaatcattgacgcgacgccgcgtaagatgttattggagacatacacaattgatgatttgagaaaagcaacagaggatttcagttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10710298 |
acacacttgatagtaaaatcattgacgcgacgccacgtaagatgttattggagacatacacaattgatgatttgagaaaagcaacagaggatttcagttc |
10710397 |
T |
 |
| Q |
211 |
aaattgt |
217 |
Q |
| |
|
||||||| |
|
|
| T |
10710398 |
aaattgt |
10710404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University