View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_high_68 (Length: 206)
Name: NF19726_high_68
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_high_68 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 46642873 - 46642701
Alignment:
| Q |
16 |
agaggcctttaggaacatttccttgaaaattgttgtatcttatgtctaagtattttaatgaaggaatgcaaagaacaacctccggaaatgttcctgagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46642873 |
agaggcctttaggaacatttccttgaaaattgttgtatcttatgtccaagtattttaatgaaggaatgcaaagaacaacctccgggaatgttcctgagaa |
46642774 |
T |
|
| Q |
116 |
ttggttgttactgatgtctagctcatggagaaggtgaaggtggttgaaactattggggagtgaaccatagaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46642773 |
ttggttgttactgatgtctagctcatggagaaggtgaaggtggttgaaactattggggagtgaaccatagaaa |
46642701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 102 - 188
Target Start/End: Complemental strand, 46640495 - 46640409
Alignment:
| Q |
102 |
aatgttcctgagaattggttgttactgatgtctagctcatggagaaggtgaaggtggttgaaactattggggagtgaaccatagaaa |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46640495 |
aatgttcctgagaattggttgttactgatgtctagctcatggagaaggtgaaggtggttgaaactattggggagtgaaccatagaaa |
46640409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University