View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_high_69 (Length: 206)
Name: NF19726_high_69
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_high_69 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 2 - 189
Target Start/End: Complemental strand, 31677778 - 31677589
Alignment:
| Q |
2 |
ttatcgcttttttctctc--cctttcagtctcgccgcatcgttgttatcctccgctccttcttccgccgctgccgcctctgttggattcggtggttttgt |
99 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31677778 |
ttatcgcttttttctctctttctcgcagtctcgccgcatcgttgttatcctccgccccttcctccgccgctgccgccgctgttggattcggtggttttgt |
31677679 |
T |
 |
| Q |
100 |
cggtagttcccgtcttgatccttctccttcaaatgaagactcctctctcccttttgcggtatgtcctattcattctataaatttctatta |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31677678 |
cggtagttcccgtcttgatccttctccttcaaatgaagactcttctctcccttttgcggtatgtcctattcattctataaatttctatta |
31677589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University