View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_28 (Length: 389)
Name: NF19726_low_28
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 92 - 215
Target Start/End: Original strand, 2991739 - 2991862
Alignment:
| Q |
92 |
aggatttgaaatgtgggcccgtgggttttttgaatttcaaaaactagtaccaaacttggcctgtttttgctttttctactaactaacgattcttttgctt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2991739 |
aggatttgaaatgtgggcccgtgggttttttgaatttcaaaaactagtaccaaacttggcctgtttttgctttttctactaactaacgattcttttgctt |
2991838 |
T |
 |
| Q |
192 |
tttggtaatttgacttgattaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2991839 |
tttggtaatttgacttgattaaag |
2991862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 294 - 376
Target Start/End: Original strand, 2991941 - 2992023
Alignment:
| Q |
294 |
aaatgtatgttatgatgttgtcttcgtttaggtatttgaggttattttttgcgatgtaacaagcaatgttttaaaatcgatat |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2991941 |
aaatgtatgttatgatgttgtcttcgtttaggtatttggggttattttttgcgatgtaataagtaatgttttaaaatcgatat |
2992023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University