View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_29 (Length: 383)
Name: NF19726_low_29
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Original strand, 32297736 - 32298111
Alignment:
| Q |
1 |
agcatactttcattattttatattgtttgcatgtgtgtataactgaactaacacagtaaaaccactggtaagaggatttcgagatccaagtacaactgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32297736 |
agcatactttcattattttatattgtttgcatgtgtgtataactgaactaacacagtaaaaccactggttagaggatttcgagatccaagtacaactgaa |
32297835 |
T |
 |
| Q |
101 |
cttaannnnnnnnnctttcttttgacaaagcaagtacaattaaacttgatcaatctatcaccttttaattatttatttatatacaagatatttcgataaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32297836 |
cttaatttttttttctttcttttgacaaagcaagtacaattaaacttgatcaatctatcaccttttaattatttatttatatacaagatatttcgataaa |
32297935 |
T |
 |
| Q |
201 |
tgggcatgtgattggtcaattgggtcttgttcttgtatgtattctaattctaatgcaggaccactaattattcaaagttcttattgatcccttcaagctc |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32297936 |
tgggcgtgtgattggtcaattgggtcttgttcttgtatgtattctaattctaatgcaggaccactaattattcaaagttcttattgatcccttcaagctc |
32298035 |
T |
 |
| Q |
301 |
attttcttctattcaattatgtcgtccaatgttgatatcactctaatgcatgcaggaccactttttaattcttctc |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32298036 |
attttcttctattcaattatgtcgtccaatgttgatatcactctaatgcatgcaggaccactttttaatccttctc |
32298111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University