View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_51 (Length: 275)
Name: NF19726_low_51
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 256
Target Start/End: Complemental strand, 46874925 - 46874686
Alignment:
| Q |
17 |
atttaccaggccacaaactgtgttctgaattgattgcgaaacagacatacgcaaggagaaactaataaattgagaagctctagtaatgtaaaatttctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874925 |
atttaccaggccacaaactgtgttctgaattgattgcgaaacagacatacgcaaggagaaactaataaattgagaagctctagtaatgtaaaatttctta |
46874826 |
T |
|
| Q |
117 |
cttcacatattaatttatgagtcttgaactcatttgagaagctttcataaatcttacaacgaataaaatacagtttggttctccagttatccacaagtcc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874825 |
cttcacatattaatttatgagtcttgaactcatttgagaagctttcataaatcttacaacgaataaaatacagtttggttctccagttatccacaagtcc |
46874726 |
T |
|
| Q |
217 |
agtacctgtatttcatacagggaaaaatgcagcacccatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874725 |
agtacctgtatttcatacagggaaaaatgcagcacccatg |
46874686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 127 - 199
Target Start/End: Complemental strand, 46892597 - 46892525
Alignment:
| Q |
127 |
taatttatgagtcttgaactcatttgagaagctttcataaatcttacaacgaataaaatacagtttggttctc |
199 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
46892597 |
taatttatgagtctagaactcaattgagaagctttcataaatcttactatgaataaaatacagtttggttctc |
46892525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University