View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_60 (Length: 247)
Name: NF19726_low_60
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_60 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 8034997 - 8034772
Alignment:
| Q |
10 |
aatattccttggtctgaattgaaccacatgtaaaataaaatccagttttcaatacctgttgaattaccgtctgtttaattaaaaataaataatcttatca |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8034997 |
aatattccttggtctgaattgaaccacatgtaaaataaaatccagttttcaatacctgttgaattaccgtctgtttagttaaaaataaataatcttatca |
8034898 |
T |
 |
| Q |
110 |
ttgatttgtttgatcgctttgaattctataggagtatttgtactactacctatcattcgtaatattaatcaaaatttatattagtgtttactattaaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8034897 |
ttgatttgtttgatcgctttgaattctataggaatatttgtactactacctatcattcgtaatattaatcaaaatttatattagtgtttactattaaaaa |
8034798 |
T |
 |
| Q |
210 |
ttttgtaatactttgttattttgaca |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8034797 |
atttgtaatactttgttattttgaca |
8034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University