View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_63 (Length: 238)
Name: NF19726_low_63
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_63 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 21 - 238
Target Start/End: Complemental strand, 2176105 - 2175888
Alignment:
| Q |
21 |
acacgatactaacatggacatgtcgatatggataaaattttnnnnnnntgagtgttgatgtcgcacacgacacatgttgaacatcaggacatatcttcaa |
120 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||| ||||||| | |||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
2176105 |
acacgacactgacatggacatgtcgatatggataaaattttaagaaaatgagtgtcggtgtcgcacacgacatatgttgaacatcagggcatatcttcaa |
2176006 |
T |
 |
| Q |
121 |
tgaggcgtgtcggtgccatatataggagaaaacagaagtacaaactagacatatgacatataggtcaagtattacatgatattgggtttcatagacatat |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2176005 |
tgaggcgtgtcggtgccatatatatgagaaagcaaaagtacaaactaaacatatgacatataggtcaagtattacatgatattgagtttcatagacatat |
2175906 |
T |
 |
| Q |
221 |
cacattaagatcgaacct |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2175905 |
cacattaagatcgaacct |
2175888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University