View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19726_low_70 (Length: 214)

Name: NF19726_low_70
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19726_low_70
NF19726_low_70
[»] chr7 (2 HSPs)
chr7 (77-200)||(433246-433365)
chr7 (22-92)||(433380-433450)
[»] chr5 (1 HSPs)
chr5 (58-103)||(39065876-39065921)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 77 - 200
Target Start/End: Complemental strand, 433365 - 433246
Alignment:
77 atctttgaaaaatggtacaaatcaagacaagaatattcagacatcgtttaagactgcgttatacttgctatggatgatgaacatgaggtaggggtgcggt 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||   |||||| |||||| |||||||| ||    
433365 atctttgaaaaatggtacaaatcaagacaagaatattcagacatcctttaagacagcgttatacttgcgatg---gatgaatatgagg-aggggtgcagt 433270  T
177 gcggtgctagatttagagaaatat 200  Q
    || || ||||||||||||||||||    
433269 gcagtactagatttagagaaatat 433246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 433450 - 433380
Alignment:
22 agcacagtttttatcccacatcctagcgttatagagtagcttatcactacttgacatctttgaaaaatggt 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
433450 agcacagtttttatcccacatcctagcgttatagagtagcttatcactacttgacatctttgaaaaatggt 433380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 103
Target Start/End: Original strand, 39065876 - 39065921
Alignment:
58 tagcttatcactacttgacatctttgaaaaatggtacaaatcaaga 103  Q
    ||||||||||||||||| | ||||||||||| ||||||| ||||||    
39065876 tagcttatcactacttggcttctttgaaaaacggtacaactcaaga 39065921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University