View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_70 (Length: 214)
Name: NF19726_low_70
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 77 - 200
Target Start/End: Complemental strand, 433365 - 433246
Alignment:
| Q |
77 |
atctttgaaaaatggtacaaatcaagacaagaatattcagacatcgtttaagactgcgttatacttgctatggatgatgaacatgaggtaggggtgcggt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||| |||||| |||||| |||||||| || |
|
|
| T |
433365 |
atctttgaaaaatggtacaaatcaagacaagaatattcagacatcctttaagacagcgttatacttgcgatg---gatgaatatgagg-aggggtgcagt |
433270 |
T |
 |
| Q |
177 |
gcggtgctagatttagagaaatat |
200 |
Q |
| |
|
|| || |||||||||||||||||| |
|
|
| T |
433269 |
gcagtactagatttagagaaatat |
433246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 433450 - 433380
Alignment:
| Q |
22 |
agcacagtttttatcccacatcctagcgttatagagtagcttatcactacttgacatctttgaaaaatggt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
433450 |
agcacagtttttatcccacatcctagcgttatagagtagcttatcactacttgacatctttgaaaaatggt |
433380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 103
Target Start/End: Original strand, 39065876 - 39065921
Alignment:
| Q |
58 |
tagcttatcactacttgacatctttgaaaaatggtacaaatcaaga |
103 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||||||| |||||| |
|
|
| T |
39065876 |
tagcttatcactacttggcttctttgaaaaacggtacaactcaaga |
39065921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University