View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19726_low_72 (Length: 206)

Name: NF19726_low_72
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19726_low_72
NF19726_low_72
[»] chr5 (1 HSPs)
chr5 (2-189)||(31677589-31677778)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 2 - 189
Target Start/End: Complemental strand, 31677778 - 31677589
Alignment:
2 ttatcgcttttttctctc--cctttcagtctcgccgcatcgttgttatcctccgctccttcttccgccgctgccgcctctgttggattcggtggttttgt 99  Q
    ||||||||||||||||||   ||  |||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||    
31677778 ttatcgcttttttctctctttctcgcagtctcgccgcatcgttgttatcctccgccccttcctccgccgctgccgccgctgttggattcggtggttttgt 31677679  T
100 cggtagttcccgtcttgatccttctccttcaaatgaagactcctctctcccttttgcggtatgtcctattcattctataaatttctatta 189  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31677678 cggtagttcccgtcttgatccttctccttcaaatgaagactcttctctcccttttgcggtatgtcctattcattctataaatttctatta 31677589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University