View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19726_low_74 (Length: 203)
Name: NF19726_low_74
Description: NF19726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19726_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 183
Target Start/End: Complemental strand, 40482834 - 40482667
Alignment:
| Q |
16 |
agcagagagtgaacatgtaaagaaaaagaaagtaaaataggataattcttgtgcaactaagttaccaaagataacttcccatctaatcatctaactaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40482834 |
agcagagagtgaacatgtaaagaaaaagaaagtaaaataggataattcttgtgcaactaagttacaaaagataacttcccatctaatcatctaactaata |
40482735 |
T |
|
| Q |
116 |
ttattgatagcaccgagactttagagtgaagacgtgtctcatacgtattagtgtccaacacaaatatc |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40482734 |
ttattgatagcaccgagactttagagtgaagacgtgtctcatacgtattagtgtccaacaccaatatc |
40482667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University