View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_high_20 (Length: 323)
Name: NF19727_high_20
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 18 - 153
Target Start/End: Complemental strand, 15582590 - 15582457
Alignment:
| Q |
18 |
ccttccccatacatatataaaaa---gacataaaccagaagaaacagaacgcacattgtcacaactgtttttgctccttatggctgtgttctattcatca |
114 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
15582590 |
ccttccccatacatatataaaaaaaagacataaaccagaagaaacagaacgcacattgtcacagctgtttttgctccttacggctgtg-----ttcatca |
15582496 |
T |
|
| Q |
115 |
actgagtcatattggttggtatttttcattccccaaatg |
153 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15582495 |
actgagtcacattggttggtatttttcattccccaaatg |
15582457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 223 - 315
Target Start/End: Complemental strand, 15582388 - 15582296
Alignment:
| Q |
223 |
ggtgtttatctgaataaattatattttagataatatgactcaacaaataataatatctaagaggagaagacatggtaatgataatgatgatgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15582388 |
ggtgtttatctgaataaattatattttagataatatgattcaacaaataataatatctaagaggagaagacatggtaatgataatgatgatgt |
15582296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University