View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_high_45 (Length: 202)
Name: NF19727_high_45
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_high_45 |
 | |
|
| [»] scaffold0160 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0160 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 11 - 183
Target Start/End: Complemental strand, 20105 - 19933
Alignment:
| Q |
11 |
cgaagaatatgaaattttttaataagaatgattcttcggttgttgaacatgaacctgttagttcggtttctgatgcaacaaccgaagaagatgttgcatt |
110 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20105 |
cgaagaaaatgaaattttttaacaagaatgattcttcggttgttgaacatgaacctgttagttcggtttctgatgcaacaaccgaagaagatgttgcatt |
20006 |
T |
|
| Q |
111 |
ttgtctaatgcagttgtcgagagacaaatggaatagacaaaatgaacaatatgaagacgtggaagatgaagat |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20005 |
ttgtctaatgcagttgtcgagagacaaatggaatagacaaaatgaacaatatgaagacgtggaagatgaagat |
19933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University