View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_27 (Length: 304)
Name: NF19727_low_27
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 11 - 282
Target Start/End: Complemental strand, 37306998 - 37306724
Alignment:
| Q |
11 |
cacagaacagtagtggcctcgggatgttgttgcagattaagttcctttaaacctttagtagcaatgaaaaccccctttgttgctgctactacattatttc |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
37306998 |
cacataacagtagtggcctcgggatgttgttgcagattaagttcctttaaacctttagtagcaatgaaaaccccttttgttgctgctactacatcatttc |
37306899 |
T |
 |
| Q |
111 |
ggagaaagagtagtagtagta---ttgtgatttgcaatgattccaacaaacagagtagcagtgttgaggagaaggaggaggttaaaagagattggacaac |
207 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37306898 |
ggagaaagagtagtagtagtagtattgtgatttgcaatgattccaacaaacagaatagcagtgttgaggagaaggaggaggttaaaagagattggacaac |
37306799 |
T |
 |
| Q |
208 |
ctcaattttactctttctcttatgggctgcacttatctactatgtttcttttctttccccaaaccagactccggt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37306798 |
ctcaattttactctttctcttatgggctgcacttatctactatgtttcttttctctccccaaaccagactccggt |
37306724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University