View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_29 (Length: 303)
Name: NF19727_low_29
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 39535584 - 39535841
Alignment:
| Q |
1 |
ggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcataccagcagacacagaatggtggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39535584 |
ggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcataccagcagacacagaatggtggta |
39535683 |
T |
|
| Q |
101 |
ctggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgatgatgatatagttggagttttatttgattctcattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39535684 |
ctggtagtaggattggaactatttacattttctttttaggctatggataattatgaattaatgatgatgatatagttggagttttattttattctcattt |
39535783 |
T |
|
| Q |
201 |
tggttgcacgtgcaaacacatgatgtattgagttagatagatattatttatccaactttgag |
262 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39535784 |
tggtttcacgtgcaaacacatgatgtattgagt----tagatattatttatccaactttgag |
39535841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 39519824 - 39519745
Alignment:
| Q |
1 |
ggagacactcacgtccaagcgctttttacccacccctccacttcctctgcagacatcaccttggaatgtagcgcatacca |
80 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39519824 |
ggagacactcacgttcaagcgctttttgcccacccctccacttcctctatagacatcaccttggaatgtagcgcatacca |
39519745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University