View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_31 (Length: 286)
Name: NF19727_low_31
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 18 - 275
Target Start/End: Original strand, 33969098 - 33969355
Alignment:
| Q |
18 |
ctaaagacctaccgccggcattgccagcaaggccaacgtcgagaggccggttgccgccggcgaggaggtctttgcctaaaagttttaaggttgacggtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33969098 |
ctaaagacctaccgccggcattgccagcaaggccaacgtcgagaggccggttgccgccggcgaggaggtctttgcctaaaagttttaaggttgatggtga |
33969197 |
T |
|
| Q |
118 |
aaatggaaatgaaatggggcatagaaggaagggaagttttggaaataagaagttgatgttggatttcgaatctccttatgtggttatttcagaagagaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33969198 |
aaatggaaatgaaatggggcatagaaggaagggaagttttggaaataagaagttgatgttggatttggaatctccttatgtggttatttcagaagagaac |
33969297 |
T |
|
| Q |
218 |
agtgttattagtgaagaagcttcaccttgtcctgtatcttcaattcctgttgatgatg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33969298 |
agtgttattagtgaagaagcttcaccttgtcccgtatcttcaattcctgttgatgatg |
33969355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University