View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_34 (Length: 264)
Name: NF19727_low_34
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 47619586 - 47619334
Alignment:
| Q |
1 |
actcacagccgttcatcttcatctattgcgagtcctactggtagcattgttgattctgattcttggaagatttgtaacccaggtaattaatgtcactcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619586 |
actcacagccgttcatcttcatctattgcgagtcctactggtagcattgttgattctgattcttggaagatttgtaacccaggtaattaatgtcactcat |
47619487 |
T |
|
| Q |
101 |
tcattattgataacccaattgttctaaattgacatggttacgttgaaaactttaatattgtagcaatagcaatgcaaacaaatgcagccaatgcggctgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47619486 |
tcattattgataacccaattgttctaaattgacatggttacgttgaaaactttaatattgtagcaatagcaatgcaaacaaatgcagccaatgaggctgc |
47619387 |
T |
|
| Q |
201 |
aattgtgattgcgatcatgtttttgagacttctaatatatttatactagaatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47619386 |
aattgtgattgcgatcatgtttttgagacttctaatatatttatactagaatt |
47619334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University