View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_40 (Length: 248)
Name: NF19727_low_40
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_40 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39099250 - 39099497
Alignment:
| Q |
1 |
gaggggttataattagagcaaagccttttcatcatgtggtaagatagttttggatttgagcccttttcacaggtacatcaccccattgacgtgggactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099250 |
gaggggttataattagagcaaagccttttcatcatgtggtaagatagttttggatttgagcccttttcacaggtacatcaccccattgacgtgggactag |
39099349 |
T |
|
| Q |
101 |
agaagttagaaagtctgggaaaattaggaccactatcgcaaaagggggaccataatttttgtgaattgtggctaagttcaacttttgtaaaaaagtgtat |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099350 |
agaagttagaaagtctgggaatattaggaccactatcgcaaaagggggaccataatttttgtgtattgtggctaagttcaacttttgtaaaaaagtgtat |
39099449 |
T |
|
| Q |
201 |
cacattggtgttggtctcaatcactaacaaagggttggaaagacaaag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39099450 |
cacattggtgttggtctcaatcactaacaaagggttggaaagacaaag |
39099497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 118 - 206
Target Start/End: Original strand, 39194543 - 39194630
Alignment:
| Q |
118 |
ggaaaattaggaccactatcgcaaaagggggaccataatttttgtgaattgtggctaagttcaacttttgtaaaaaagtgtatcacatt |
206 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||| |||||||||||||||||||| ||||||||| || |||| |||||||||||| |
|
|
| T |
39194543 |
ggaaaattaggacgactggagcaaaagggaaaccaatttttttgtgaattgtggctaaattcaactttcgt-aaaacgtgtatcacatt |
39194630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 204 - 240
Target Start/End: Original strand, 39194675 - 39194711
Alignment:
| Q |
204 |
attggtgttggtctcaatcactaacaaagggttggaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39194675 |
attggtgttggtctaaatcactaacaaagggttggaa |
39194711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University