View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_43 (Length: 242)
Name: NF19727_low_43
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 14 - 224
Target Start/End: Complemental strand, 5442178 - 5441968
Alignment:
| Q |
14 |
atacatacacacacgaaatcaattttgattcaaattaactaaacatattttaatcaattaagtcaaaattaannnnnnncattacaatgatactccgtnn |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
5442178 |
atacatacacacacgaaatcaatttagattcaaattaactaaacatattttaatcaattcagtcaaaattaatttttttcattacaatgatactccgtaa |
5442079 |
T |
 |
| Q |
114 |
nnnnnnttacattgttttgctgcaaaaattactcatttcatagtaattgttttacaaatgaaattctcacttttaggcattatatagtgataactcatca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442078 |
aaaaaattacattgttttgctgcaaaaattactcatttcatagtaattgttttacaaatgaaattctcacttttaggcattatatagtgataactcatca |
5441979 |
T |
 |
| Q |
214 |
tttactgtggg |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
5441978 |
tttactgtggg |
5441968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University