View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_46 (Length: 230)
Name: NF19727_low_46
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_46 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 95 - 230
Target Start/End: Original strand, 48569420 - 48569549
Alignment:
| Q |
95 |
ttcctttgctgaaatcttccgatagaaattcttcgtcatgatcaagtcccaagtaattgctaaaaacaagtttgactttagaaaatgcgaggattttgtt |
194 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48569420 |
ttcctttgctgaaatcttccgatataaattcttcttca------agtcccaagtaattgctaaaaacaagtttgactttagaaaatgcgaggattttgtt |
48569513 |
T |
|
| Q |
195 |
tgggtgacagaggatgaattgatggagtattttccc |
230 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48569514 |
tgggtgacaaaggatgaattgatggagtattttccc |
48569549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 48569354 - 48569421
Alignment:
| Q |
1 |
tttcctttctttggttgtaccacagcctttccaatacttctgttttctgtgtgaaaattgattatgaatt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48569354 |
tttcctttctttggttgtaccacagcctttccaatacttctgttttc--tgtgaaaattgattatgaatt |
48569421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 77 - 229
Target Start/End: Complemental strand, 10821612 - 10821466
Alignment:
| Q |
77 |
attatacttgctcattttttcctttgctgaaatcttccgatagaaattcttcgtcatgatcaagtcccaagtaattgctaaaaacaagtttgactttaga |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| | ||||||||||| ||| | || ||||||||||||||||||||||| ||| || | |
|
|
| T |
10821612 |
attatacttgctcattctttcctttgcttaaatcttctgtcagaaattcttcttca------aatcacaagtaattgctaaaaacaagttcgacattggc |
10821519 |
T |
|
| Q |
177 |
aaatgcgaggattttgtttgggtgacagaggatgaattgatggagtattttcc |
229 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10821518 |
aaatgcgaggactttgtttgggtgactaaggatgaattgattgagtattttcc |
10821466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 144 - 229
Target Start/End: Original strand, 36145837 - 36145922
Alignment:
| Q |
144 |
caagtaattgctaaaaacaagtttgactttagaaaatgcgaggattttgtttgggtgacagaggatgaattgatggagtattttcc |
229 |
Q |
| |
|
||||||||||||||||||||||| ||| || | ||| | ||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36145837 |
caagtaattgctaaaaacaagttcgacattggcaaaggtgaggactttgtttgggtgactaaggatgaattgatggagtattttcc |
36145922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University