View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_50 (Length: 215)
Name: NF19727_low_50
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_50 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 72 - 215
Target Start/End: Complemental strand, 4297345 - 4297202
Alignment:
| Q |
72 |
gtgttggtggtgcaccattagattcagtaatcatgcatgatctaatggttgtttttaaaataaaaagatctaaccgttaaaattaatgaggtcaatgata |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4297345 |
gtgttggtggtgcaccattagattcagtaatcatgcatgatctaatggttgtttttaaaataaaaagatctaaccgttaaaattaatgagatcaatgata |
4297246 |
T |
|
| Q |
172 |
gaccatctttattgtcggtccaccttaaacgttagagttaaaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4297245 |
gaccatctttattgtcggtccaccttaaacgttagagttaaaag |
4297202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 75 - 180
Target Start/End: Complemental strand, 4257234 - 4257129
Alignment:
| Q |
75 |
ttggtggtgcaccattagattcagtaatcatgcatgatctaatggttgtttttaaaataaaaagatctaaccgttaaaattaatgaggtcaatgatagac |
174 |
Q |
| |
|
|||||||||||||| |||||| | || ||||||||||||||||||||||||| || ||||||||||||| |||||||||||||||||| ||||| ||| |
|
|
| T |
4257234 |
ttggtggtgcaccactagatttaatagacatgcatgatctaatggttgtttttttaacaaaaagatctaacggttaaaattaatgaggtctatgatcgac |
4257135 |
T |
|
| Q |
175 |
catctt |
180 |
Q |
| |
|
|||||| |
|
|
| T |
4257134 |
catctt |
4257129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University