View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19727_low_53 (Length: 209)

Name: NF19727_low_53
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19727_low_53
NF19727_low_53
[»] chr2 (1 HSPs)
chr2 (138-182)||(30986784-30986828)
[»] chr4 (1 HSPs)
chr4 (149-181)||(35507142-35507174)


Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 182
Target Start/End: Complemental strand, 30986828 - 30986784
Alignment:
138 tttattaccttaatttgtcacttatttccatttttagcttcttag 182  Q
    |||||||||||||||||||||||||||||||||||| ||||||||    
30986828 tttattaccttaatttgtcacttatttccatttttaccttcttag 30986784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 35507174 - 35507142
Alignment:
149 aatttgtcacttatttccatttttagcttctta 181  Q
    ||||| |||||||||||||||||||||||||||    
35507174 aatttatcacttatttccatttttagcttctta 35507142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University