View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19727_low_53 (Length: 209)
Name: NF19727_low_53
Description: NF19727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19727_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 138 - 182
Target Start/End: Complemental strand, 30986828 - 30986784
Alignment:
| Q |
138 |
tttattaccttaatttgtcacttatttccatttttagcttcttag |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30986828 |
tttattaccttaatttgtcacttatttccatttttaccttcttag |
30986784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 35507174 - 35507142
Alignment:
| Q |
149 |
aatttgtcacttatttccatttttagcttctta |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
35507174 |
aatttatcacttatttccatttttagcttctta |
35507142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University