View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19728_high_4 (Length: 389)
Name: NF19728_high_4
Description: NF19728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19728_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 379
Target Start/End: Complemental strand, 14256097 - 14255740
Alignment:
| Q |
18 |
tgaacatgatttttgttgttcaagagtgtgcttataggaataaatgggtttgagtgtgtatgtctgttgtagttcattcctgatgagggatgaggactgt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14256097 |
tgaacatgatttttgttgttcaagagtgtgcttataggaataaatgggtttgagtgtgtatgtctgttgtagttcattcctgatgagggctgaggactgt |
14255998 |
T |
 |
| Q |
118 |
ttctcatcaagggaatgtaaatatttagtgttattatgatatgatcccttgtaggagggatttacaaatattgatcattagaaatttatattgagagtgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14255997 |
ttctcatcaagggaatgtaaatatttagtgttattatgatatgatcccttgtagg---gatttacaaatattgatcatt-gaaatttatattgagagtgg |
14255902 |
T |
 |
| Q |
218 |
tttgttactttgttgttttagtgctttatttctatagttggtttatcttatgtcttcttgcatttgatttttgatagcacatagggcttgaagatcagaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14255901 |
tttgttactttgttgttttagtgctttatttctatagttggtttatcttatgtcttcttgcatttgatttttgatagcacatagggcttgaagatcagaa |
14255802 |
T |
 |
| Q |
318 |
caccttcaatcgtgcatgtcccaatgcaatatgtgcgtatatatgtgataactgaattcatc |
379 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
14255801 |
caccttcaatcctgcatgttccaatgcaatatgtgcatatatctgtgataactgaattcatc |
14255740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University