View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19728_low_6 (Length: 345)
Name: NF19728_low_6
Description: NF19728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19728_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 5595812 - 5595478
Alignment:
| Q |
16 |
gatcatgtgttctttcactgcccatttgcaatgcaggtgtggcagcgaagtggtctttggcatctgtttcagcaagcgctgctgcaaagtactacaacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5595812 |
gatcatgtgttctttcactgcccatttgcaatgcaggtatggcagcgaagtggtctttggcatctgtttcagcaagcgctgctgcaaagtactacaacag |
5595713 |
T |
 |
| Q |
116 |
tcgaagctatttttcaattgttacatgatttggctactgataattcgcgacgttttgctgttactatatggagtctttggaagcataagaatcttaaact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5595712 |
tcgaagctatttttcaattgttacatgatttggcttctaataattcgcgacgttttgctgttactatatggagtctttggaagcataggaatcttaaact |
5595613 |
T |
 |
| Q |
216 |
ttgggacaacactcc---------------------ggaccgtgcagttagaatgttggaagattggaagctagcaaacaatatctctagcaatgcacat |
294 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5595612 |
ttggaacaacactccggaaactatggcacaggttgtggaccgtgcagttagaatgttggaagattggaagccagcaaacaatatctctagcaatgcacat |
5595513 |
T |
 |
| Q |
295 |
gctgttcatgacagaaacaacagcaatgatccaca |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5595512 |
gctgttcatgacagaaacaacagcaatgatccaca |
5595478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University