View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19730_high_8 (Length: 346)
Name: NF19730_high_8
Description: NF19730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19730_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 42068157 - 42068482
Alignment:
| Q |
1 |
tttacttctctcaaaatcactgcaaatctaataccttagttgaggatgtttcaaacatggaagtattgattggatcgtggttgagaggtctatgtgaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42068157 |
tttacttctctcaaaatcactgcaaatctaataccttagttgaggatgtttcaaacatggaagtattgattggatcgtggttgagaggtctatgtgaagc |
42068256 |
T |
|
| Q |
101 |
atatgtttatcgtgaagtaaatagtgttgttgattggtcaattggcaaactatactcagaatcaatacta--ctctctatcttctatcacccctcaagtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42068257 |
--atgtttatcgtgaagtaaatagtgttgttgattggtcaattggcaaactatactcagaatcaatactaccctctctatcttctatcacccctcaagtg |
42068354 |
T |
|
| Q |
199 |
ggttgtatttttgtttgctcatgaag---ggagctcgggttccacgttgaatcaagggcaaccatataaatgatttaaacataatattttaacgtaaaat |
295 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42068355 |
ggttgtatttttgtttgatcatgaagggaggagctcgggttccacgttgaatcaagggcaatcatataaatgagttaaacataatattttaacgtaaaat |
42068454 |
T |
|
| Q |
296 |
cttaatacattttgtatatgggtcatct |
323 |
Q |
| |
|
||||| | |||||||||||||||||||| |
|
|
| T |
42068455 |
cttaagatattttgtatatgggtcatct |
42068482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University