View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19731_low_3 (Length: 255)
Name: NF19731_low_3
Description: NF19731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19731_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 78 - 239
Target Start/End: Original strand, 27653471 - 27653632
Alignment:
| Q |
78 |
aaagatagaactactagttgatactttcaagttcaacaacagttttgaaccacaataacaagttaatttggattcatcaaggagaccatcaaagatcgtt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27653471 |
aaagatagaactactagttgatactttcaagttcaacaacagttttgaaccacaataacaagttaatttggattcatcaaggagaccatcaaagatcgtt |
27653570 |
T |
 |
| Q |
178 |
tttaattatccaagagattgagtcaccagttgtgaatagcatattgactataggcttgattc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27653571 |
tttaattatccaagagattgagtcaccagttgtgaatagcatattgactataggcttgattc |
27653632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University