View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19734_high_4 (Length: 298)
Name: NF19734_high_4
Description: NF19734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19734_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 11 - 282
Target Start/End: Original strand, 25882302 - 25882573
Alignment:
| Q |
11 |
atgaaccggtcaaagaaaggattgagtcctggtttgattattattataacagtggctgatgctgctgctgtggcattgattggtcttgttgttgtgtatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882302 |
atgaaccggtcaaagaaaggattgagtcctggtttgattattattataacagtggctgatgctgctgctgtggcattgattggtcttgttgttgtgtatg |
25882401 |
T |
|
| Q |
111 |
tgtattggaagaaaaaggataagaataatgggtgtagttgtactttgaagaggaaatttggtggtaatggaagcaacgaaagatcgaattcgtgttgttt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882402 |
tgtattggaagaaaaaggataagaataatggatgtagttgtactttgaagagaaaatttggtggtaatggaagcaacgaaagatcgaattcgtgttgttt |
25882501 |
T |
|
| Q |
211 |
gtgtatggctttaggttgtgtaaaagggtttaagagtgatgattcagagatggaagagagtgagaaaggagg |
282 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882502 |
gtgtttggctttaggttgtgtaaaagggtttaagagtgatgattcagagatggaagagagtgagaaaggagg |
25882573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University