View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19734_low_11 (Length: 245)
Name: NF19734_low_11
Description: NF19734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19734_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 5 - 188
Target Start/End: Original strand, 21598028 - 21598212
Alignment:
| Q |
5 |
attttcactggcttttggaagaacgagaagttcatgagagtctgttgaacggttgaagaggcggtctttgaggcgtgggcaggtgtttgttaaggcggat |
104 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||| ||||||||||| ||||| | ||| |||||||| || |||||||||||||||| |||||||| | |
|
|
| T |
21598028 |
attttcactggctttgggaaggacgagaagttcatgggagtctgttgatcggtttaggagacggtcttttagacgtgggcaggtgtttgctaaggcggtt |
21598127 |
T |
|
| Q |
105 |
cggtaggattttccgg-ttggaaagatggttctgggaagaaatcttgcttgctccatcgccagtagcttcgtggctttgtaggtg |
188 |
Q |
| |
|
|| |||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
21598128 |
cgataggtttctccggtttggaaagatggttctgggaagaaatcttgcttgctccatcgccagtagcttcgtggttttgaaggtg |
21598212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University