View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19734_low_7 (Length: 415)
Name: NF19734_low_7
Description: NF19734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19734_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 15 - 398
Target Start/End: Complemental strand, 33838940 - 33838557
Alignment:
| Q |
15 |
gaccagatatgtgaaagtgaggacattacctttggtgtggtcctataattttggcatcatttttagacaataaggacaaacaaacaaacttttacccttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33838940 |
gaccagatatgtgaaagtgaggacattacctttggtgtggtcctataattttggcatcatttttagacaataaggacaaacaaacaaacttttacccttc |
33838841 |
T |
|
| Q |
115 |
tgattcactaaccagctttgtcatctccattttgcaatcaaccacaacatgcatgtggtgattaattatcttataattgaacctttattaattttgaaca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33838840 |
tgattcactaaccagctttgtcatctccattttgcaatcaaccacaacatgcatgtggtgattaattatcttataattgaacctttattaattttgaaca |
33838741 |
T |
|
| Q |
215 |
tcttaatcacgtgccttgccaactttatagctcttgtattttgtctaaacctaaacactaaagtcttgaagcctccaaaacaatggtcggacacaagttt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33838740 |
tcttaatcacgtgccttgccaactttatagctcttgtattttgtctaaacctaaacactaaagtcttgaagcctccaaaacaatggtcggacacaagttt |
33838641 |
T |
|
| Q |
315 |
caaaggttggattgtagtcatgatattctacaagatccaaaaaattatcacatgtaatcatgtgactactagctatggaaatat |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33838640 |
caaaggttggattgtagtcatgatattctacaagatccaaaaaattatcacatgtaatcatgtgactactagctatggaaatat |
33838557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University