View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19735_low_3 (Length: 313)
Name: NF19735_low_3
Description: NF19735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19735_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 10598834 - 10599130
Alignment:
| Q |
1 |
acacctgttttgagcatatcatagaacaattctagtgcttttgtagcaaacccatgttttgcaaaaccatttatgatagaggtccaagttatgacattgc |
100 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10598834 |
acacctgtttcaagcatattatagaacaattctagtgcttttgaagcaaatccatgttttgcaaaaccatttatgatagaggtccaagttatgacattgc |
10598933 |
T |
|
| Q |
101 |
gatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttagaatacatagagatcaaagcattattaacacttaggtcagtccgaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10598934 |
aatcttccatgtcattaaagacctgtaaagcagcttctttgtttccacacttggaatacatagagatcaaagcattattaacacttaagtcagtccgaaa |
10599033 |
T |
|
| Q |
201 |
tctcatcttcaccaccatggcatgaatttgttcacccttacctattgtaccaatacaagcagcaccactcaacaggctagcatataaaaacgaacta |
297 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
10599034 |
tccaatcttaaccaccatggcatgaatttgttcacccttaccaattgtaccaatacaagcagcaccactcaagaggctagcatatgtaaacgaacta |
10599130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University