View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19736_low_9 (Length: 329)
Name: NF19736_low_9
Description: NF19736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19736_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 16 - 314
Target Start/End: Original strand, 44892402 - 44892697
Alignment:
| Q |
16 |
atgctacatgactacttgtataagtatgtataagtacagctttacacttcaattgccttctatttatgcagctacttgtatttcagtgaggtcactcgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44892402 |
atgctacatgactacttgtataagtatgtataagtacagctttacacttcaattgccttctatttatgcat----ttgtatttcagtgaggtcactcgtt |
44892497 |
T |
|
| Q |
116 |
tacataactatcgtggttattttttagtactaacactcttaatatatctttatctttttaatttacccatctactacaagatttcatgaattaagcttca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44892498 |
tacataactatcgtggttattttttagtactaacactcttaatatatctttatctatttaatttacccatctactacaagatttcatgaattaagcttca |
44892597 |
T |
|
| Q |
216 |
ggtaaaatatatatggtgattttaagtttctttatcgaagcgtatgacatgctttctg-aattatattatttccaaatctgaaagatgaagacaaatact |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44892598 |
ggtaaaatatatatggtgattttaagtttctttatcaaagcgtatgacatgctttctgaaattatattatttccaaacctgaaagatgaagacaaatact |
44892697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University