View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19737_high_13 (Length: 235)
Name: NF19737_high_13
Description: NF19737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19737_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 125 - 226
Target Start/End: Complemental strand, 8290095 - 8289994
Alignment:
| Q |
125 |
ataatttgtaataaaagaactctaaatttattctcacaattctatgactaattaagttaagataaaataggaattaccatatttttggtagttgacaatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8290095 |
ataatttgtaataaaagaactctaaatttattctaacaattctatgactaattaagttaagataaaataggaattaccatatttttggtagttgacaatg |
8289996 |
T |
 |
| Q |
225 |
at |
226 |
Q |
| |
|
|| |
|
|
| T |
8289995 |
at |
8289994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University