View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19737_low_12 (Length: 247)
Name: NF19737_low_12
Description: NF19737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19737_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 13025483 - 13025717
Alignment:
| Q |
1 |
ccttgtccctttcattaaaagaattccttgctgattctaacctttgtaaaatttgatgcatatgttgtggatttgatgatgggtgagatgatttaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13025483 |
ccttgtccctttcattaaaagaattccttgctgattctaacctttgtaaaatttgatgcatatgttgtggatttgatgatgggttagatgatttaaattc |
13025582 |
T |
 |
| Q |
101 |
agtggctgcaaggtttgtcatgaatgcaagtttttgttctatgtcttcatgtgaatgtggaccacgtattattccatcttcaagcattgattcgacttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13025583 |
agtggctgcaaggtttgtcatgaatgcaagtttttgttctatgtcttcatgtgaatgtggaccacgtattattccatcttcaagcattgattccacttct |
13025682 |
T |
 |
| Q |
201 |
ttgagttttgtcttcaaaatttgtaagttagccat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13025683 |
ttgagttttgtcttcaaaatttgtaagttagccat |
13025717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 66 - 219
Target Start/End: Original strand, 5981248 - 5981401
Alignment:
| Q |
66 |
tgtggatttgatgatgggtgagatgatttaaattcagtggctgcaaggtttgtcatgaatgcaagtttttgttctatgtcttcatgtgaatgtggaccac |
165 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| | |||||||| ||||||||||| |||||||||||| ||||| ||||||| |||| ||| |
|
|
| T |
5981248 |
tgtggatttgatgatgggtcagatgattcaaattcagcatgtataaggtttgacatgaatgcaaatttttgttctatttcttcttgtgaatttggatcac |
5981347 |
T |
 |
| Q |
166 |
gtattattccatcttcaagcattgattcgacttctttgagttttgtcttcaaaa |
219 |
Q |
| |
|
||| |||||| || || |||||||||| |||||||||||||| ||||||| |
|
|
| T |
5981348 |
gtagtattccttcagtgagaattgattcgagttctttgagttttgctttcaaaa |
5981401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University