View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19738_high_19 (Length: 204)
Name: NF19738_high_19
Description: NF19738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19738_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 17 - 155
Target Start/End: Original strand, 28009492 - 28009630
Alignment:
| Q |
17 |
caagagcttgggaagttggttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009492 |
caagagcttgggaagttggttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttg |
28009591 |
T |
|
| Q |
117 |
gaatgcttcaacttatggaaacatttagcaaggtaattg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28009592 |
gaatgcttcaacttatggaaacatttagcaaggtaattg |
28009630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 26427389 - 26427251
Alignment:
| Q |
17 |
caagagcttgggaagttggttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427389 |
caagagcttgggaagttggttcctggtggaccaaagatgaacacagcagagatgcttaatgctgctgctaattatgtcaagtttcttcaagctcaagttg |
26427290 |
T |
|
| Q |
117 |
gaatgcttcaacttatggaaacatttagcaaggtaattg |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26427289 |
gaatgcttcaacttatggaaacatttagcaaggtaattg |
26427251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University