View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19738_low_14 (Length: 309)
Name: NF19738_low_14
Description: NF19738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19738_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 9214652 - 9214359
Alignment:
| Q |
1 |
aattgttttttatttgagtaagtaaagttgttgatggnnnnnnnatattgaagcacgatgtgtggtttaaaggggaatttggaagaagttgttggagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9214652 |
aattgttttttatttgagtaagtaacgttgttgatggtttttttatattgaagcacgatgtgtggtttaaaggggaatttagaagaagttgttggagttc |
9214553 |
T |
 |
| Q |
101 |
caacctcggtgccagtgcgtgtagctcacgagcttcttctagctggccataagtatttggatgtaaggtaaagtaaccgattaatatatacttactgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9214552 |
caacctcggtgccagtgcgtgtagctcacgagcttcttctagctggccataagtatttggatgtaaggtaaagtaaccgattaa--tatacttactgata |
9214455 |
T |
 |
| Q |
201 |
atgttttggaattgtgatttggaagaagccaaaactcacgactttccatacctgtttattgtgattgtgcaggaccacggaagagtttaatgctggacac |
300 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9214454 |
atgt-------------tttggaagaagccaaaaatcacgactttccatacctgtttattgtgattgtgcaggaccacggaagagtttaatgctggacac |
9214368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University