View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19738_low_19 (Length: 237)
Name: NF19738_low_19
Description: NF19738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19738_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 13334383 - 13334152
Alignment:
| Q |
1 |
ttatgatgctcagcatcttattagcaagtgcataaacatgctgaaattaaaaattaa-ctttatttatctagtgaagtacaatttgtttaataatcataa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13334383 |
ttatgatgctcagcatcttattagcaagtgcataaacatgctgaaattaaaaattaaactttatttatctagtgaagtacaatttgtttaataatcataa |
13334284 |
T |
|
| Q |
100 |
catattcatatcatccattaagttc----------aggaaacataaacattacaacaatagaaacataaaagaacttagcaatagtaatatcctttgaac |
189 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13334283 |
catattcatatcatccattaagttcatccttattaaggaaacataaacattataactatagaaacataaaagaacttagcaatagtaatatcctttgaac |
13334184 |
T |
|
| Q |
190 |
acacactttattttcttcttccatatgtgatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13334183 |
acacactttattttcttcttccatatgtgatg |
13334152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University