View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19741_high_5 (Length: 244)
Name: NF19741_high_5
Description: NF19741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19741_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 5726751 - 5726522
Alignment:
| Q |
1 |
taaaaccaccacc-ttcctgtattttctcactaaaaatgttttttatttctgaccggannnnnnnnaattcttaatacccaaattaatccttgnnnnnnn |
99 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5726751 |
taaaaccacccccattcctttattttctcactaaaaatgttttttatttctgaccggattttttttaattcttaatacccaaattaatccttgttttttt |
5726652 |
T |
 |
| Q |
100 |
nnccaacatacaaaaacccttcggaaaaagaagatattaattggtatttctctctattcttatttgtgaaaactatcatgaatatgatcacttctcaata |
199 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726651 |
t-ccaacatacacaaacccttcggaaaaagaagatattaattggtatttctctctattcttatttgtgaaaactatcatgaatatgatcacttctcaata |
5726553 |
T |
 |
| Q |
200 |
ttcttaattactttcgtgaaatattcaattt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5726552 |
ttcttaattactttcgtgaaatattcaattt |
5726522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University