View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19742_high_32 (Length: 246)
Name: NF19742_high_32
Description: NF19742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19742_high_32 |
 | |
|
| [»] scaffold0287 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0287 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 16080 - 16272
Alignment:
| Q |
18 |
gccaggactttctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtcacaaggaaaagaaagaatgcttgctggtaattag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16080 |
gccaggactttctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtcacaaggaaaagaaagaatgcttgctggtaattag |
16179 |
T |
|
| Q |
118 |
actgtggaggaatgcttgnnnnnnnnatgcataagggtatatgtcatgtatcacaaattcactatgtctgcttgcttgtgatgtaagtttttt |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16180 |
actgtggaggaatgcttgttttttttatgcataagggtatatgtcatgtatcacaaattcactatgtctgcttgcttgtggtgcaagtttttt |
16272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 3630005 - 3629813
Alignment:
| Q |
18 |
gccaggactttctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtcacaaggaaaagaaagaatgcttgctggtaattag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3630005 |
gccaggactttctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtcacaaggaaaagaaagaatgcttgctggtaattag |
3629906 |
T |
|
| Q |
118 |
actgtggaggaatgcttgnnnnnnnnatgcataagggtatatgtcatgtatcacaaattcactatgtctgcttgcttgtgatgtaagtttttt |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3629905 |
actgtggaggaatgcttgttttttttatgcataagggtatatgtcatgtatcacaaattcactatgtctgcttgcttgtggtgcaagtttttt |
3629813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 3619629 - 3619564
Alignment:
| Q |
18 |
gccaggactttctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtc |
83 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3619629 |
gccaggacttgctagacacaagaagaatcacctttgccttgttgccaagaatcacatgtaaatgtc |
3619564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University