View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19742_low_27 (Length: 291)
Name: NF19742_low_27
Description: NF19742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19742_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 284
Target Start/End: Complemental strand, 38243949 - 38243665
Alignment:
| Q |
1 |
ccgtattatggaccatccgccgatgaagttttcgccaagcgtaaacagttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38243949 |
ccgtattatggaccatccgccgatgaagttttctccaagcgtaaacagttccttggtccttccttgttccatttctatcaaaaacccgtcagttcctatc |
38243850 |
T |
 |
| Q |
101 |
atcaaactcatttctcttctttaatttcatttattgtttgttac-nnnnnnnnatagaagaagaaattgatgatgaatgatgtttgtatagttgaatatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38243849 |
atcaaactcatttctcttctttaatttcatttattgtttgttactttttttttatagaagaagaaattgatgatgaatgatgtttttatagttgaatatt |
38243750 |
T |
 |
| Q |
200 |
gtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtctctgctg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38243749 |
gtggaggggaagatgcaatatctgtatgatgaagctggaagacgttaccttgatgcttttgctgggattgttactgtttctgctg |
38243665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University