View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19742_low_40 (Length: 222)
Name: NF19742_low_40
Description: NF19742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19742_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 13923595 - 13923815
Alignment:
| Q |
1 |
cgatttgtcagtgtcgtgtctgtgttagtatctatacttcataactatttgcttatttgatgttttgaaaatgtaattgcttgtttctagctgagtgcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13923595 |
cgatttgtcagtgtcgtgtctgtgttagtatctatacttcataactatttgcttatttgatgttttgaaaatgtaattgcttgattctagctgagtgcta |
13923694 |
T |
 |
| Q |
101 |
tttcagctaactttcattgattttgcttgacaaagttgattgcacgcttgcagcgtctgaattctccagttatagctga--------aggaggaggagga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
13923695 |
tttcagctaactttcattgattttgcttgacaaagttgattgcacgcttgcagcg---------tccagttatagctgaagatgatgaggaggaggagga |
13923785 |
T |
 |
| Q |
193 |
ttagtgaaattgaattgaaaatgcaagcaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13923786 |
ttagtgaaattgaattgaaaatgcaagcaa |
13923815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University