View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19742_low_41 (Length: 209)
Name: NF19742_low_41
Description: NF19742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19742_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 30873998 - 30874180
Alignment:
| Q |
14 |
cacagatccctctttgacgctttcttgcataggtagccacagagtcaaacacatcacaaccactacttacttcaaggatgtgagccctaagtgtgtttgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30873998 |
cacagatccctctttgacgctttcttgcataagtagccacagagtcaaacacatcacaaccactacttacttcaaggatgtgagccctaagtgtgtttgc |
30874097 |
T |
|
| Q |
114 |
actctctcttgtgatgatcaccggtggtttaggtttgttctttgagcccggaggtcttcccctcggcctgcgaccaactacat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874098 |
actctctcttgtgatgatcaccggtggtttaggtttgttctttgagcccggaggtcttcccctcggcctgcgaccaactacat |
30874180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 82 - 143
Target Start/End: Complemental strand, 40541580 - 40541519
Alignment:
| Q |
82 |
acttcaaggatgtgagccctaagtgtgtttgcactctctcttgtgatgatcaccggtggttt |
143 |
Q |
| |
|
|||||||| || ||||| || || ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
40541580 |
acttcaagaatatgagctctgagagtgttggcactctctcgagtgatgatcaccggtggttt |
40541519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University