View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19743_low_3 (Length: 277)
Name: NF19743_low_3
Description: NF19743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19743_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 250
Target Start/End: Original strand, 28208474 - 28208699
Alignment:
| Q |
25 |
taatatttgtggaggtttaaaatctggacatcctttgcatcttttgacttagtgcatattgtaagtgtttagaatatatggctgcaacattcatgaacat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28208474 |
taatatttgtggaggtttaaaatctggacatcctttgcatcttttgacttagtgcatattgtaagtgtttagaatatatggctgcaacattcatgaacat |
28208573 |
T |
|
| Q |
125 |
atattaaattcgaccatatatacatattcaaaatggtgaagacaaaagaaattaatctagattgaaatactttgaagatatacatgtctttagtgccttg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
28208574 |
atattaaattcgaccatatatacatattcaaaatggtgaagacaaaagaaattaatctagattgaaatactttgaagatatacatgtctctagtggcttg |
28208673 |
T |
|
| Q |
225 |
tacactttactacattcgtagaggag |
250 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
28208674 |
tacactttactacattcatagaggag |
28208699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University