View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_11 (Length: 420)
Name: NF19744_high_11
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 328 - 403
Target Start/End: Complemental strand, 48518486 - 48518411
Alignment:
| Q |
328 |
taaccaagaaagtcctcatcttcattctccaaagactggaatcattattgttcttgaatttctccacctagaactt |
403 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48518486 |
taaccaagaaaatcctcatcttcattctccaaagactggaatcattattgttcttgaatttctccacctagaactt |
48518411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University