View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_14 (Length: 398)
Name: NF19744_high_14
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 20 - 381
Target Start/End: Complemental strand, 43924105 - 43923744
Alignment:
| Q |
20 |
gttcggatcatttataaattccaactaaacataattatcttcattaattgnnnnnnnctctcttaattattaggaatcagagtggcttagggttacttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924105 |
gttcggatcatttataaattccaactaaacataattatcttcattaattgtttttttctctcataattattaggaatcagagtggcttagggttacttta |
43924006 |
T |
 |
| Q |
120 |
cataaatggttggatgatgaatactgtcctgaggaaacaaatgtggagataagcagagttgctgcaaaatcctactacaattctttgatacggaaacaag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43924005 |
cataaatggttggatgatgaatactgtcctgaggaaacaaatgtggagataagcagagttgctgcaaaatcctactataattctttgatacggaaacaag |
43923906 |
T |
 |
| Q |
220 |
ctgatttagctgacattttgttgaatatggcacgtgaattggaaaccatttcttataaggaaagttttcatggggcatacacatctgcaaatgcggctgt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43923905 |
ctgatttagctgacattttgttgaatatggcacgtgaattggaaaccatttcttataaggaaagttttcatggggcatacacatctgcaaatgcggctgt |
43923806 |
T |
 |
| Q |
320 |
aaacctaattgcgcagcggattgaacaattatgccacccaaattaaattccatagctccaca |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43923805 |
aaacctaattgcgcagcggattgaacaattatgccacccaaattaaattccatagctccaca |
43923744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University