View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19744_high_18 (Length: 357)
Name: NF19744_high_18
Description: NF19744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19744_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 97 - 350
Target Start/End: Complemental strand, 40374508 - 40374255
Alignment:
| Q |
97 |
ggcttattagaataaagttagctctatttggatattagaaattttcattttggtattttggtgtttgatgtgtatttttcttcctaggctttagtaggca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40374508 |
ggcttattagaataaagttagctctatttggatattagaaattttcattttggtattttggtgtttgatgtgtatttttcttcctaggctttagtaggca |
40374409 |
T |
|
| Q |
197 |
tacttctttcacaaaaaagatataggtgtgtggatcatgacgtatcttctaggtttaggccactcacaaagtaatctactagtgcattatcaagtccata |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40374408 |
tacttctttcacaaaaaagatataggtgtgtggatcatgacgtatcttctaggtttaggccactcacaaagtaatctactagtgcattatcaagtccata |
40374309 |
T |
|
| Q |
297 |
aaatttattagttgtcgaaaaaatgagtattctgaactgtttttgtgatgatgt |
350 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40374308 |
aaatttattagttgtcgacaaaatgagtattctgaactgtttttgtgatgatgt |
40374255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 40374591 - 40374553
Alignment:
| Q |
19 |
atcagtagcataaacctttgttccttctttgctgcattt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40374591 |
atcagtagcataaacctttgttccttctttgctgcattt |
40374553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University